First Report of Pyrenophora tritici–repentis in Wheat (Triticum aestivum L.) in Korea and in vitro Selection of an Effective Fungicide

Korean Journal of Mycology (Kor J Mycol) 2023 December, Volume 51, Issue 4, pages 286. https://doi.org/10.4489/KJM.20230030
Received on August 16, 2023, Revised on November 06, 2023, Accepted on November 08, 2023.
Copyright © The Korean Society of Mycology.
This is an Open Access article which is freely available under the Creative Commons Attribution-NonCommercial 4.0 International License (CC BY-NC) (https://creativecommons.org/licenses/by-nc/4.0/).

ABSTRACT

Tan spot, caused by Pyrenophora tritici-repentis, is a major foliar disease in wheat worldwide. In April 2021, tan spot symptoms were observed in a commercial wheat field in Suncheon, Jeonnam Province, Korea, with over 5% of the wheat leaves exhibiting symptoms. These symptoms included oval-shaped tan necrosis surrounded by a bright halo. The three representative isolates exhibited irregular mycelial growth on V8-potato dextrose agar and produced pseudothecia. Based on the concatenated sequence datasets of four multi-genes, including the internal transcribed spacer, large subunit ribosomal RNA, glyceraldehyde3-phosphate dehydrogenase, and RNA polymerase II second-largest subunit genes, phylogenetic analysis revealed that these three isolates clustered in the same clade as P. tritici-repentis. Results of pathogenicity test indicated that the initial symptoms appeared 5 days post-inoculation (dpi), with typical tan spot symptoms developing at 7 dpi. The pathogen was successfully re-isolated from the symptomatic tissues, thus fulfilling Koch's postulates. Furthermore, we selected three fungicides that effectively inhibited the mycelial growth of P. tritici-repentis by more than 90% in vitro. To the best of our knowledge, this is the first report of tan spot disease in wheat in Korea.

INTRODUCTION

Tan spot, caused by Pyrenophora tritici-repentis (Died.) Drechs., is a major disease affecting wheat worldwide [1]. Since its first report in the United States, the disease incidence and severity have been increasing in wheat grown worldwide [2,3]. Although the plant pathogen has primarily been isolated from wheat, it has also been reported to have a relatively broad host range, including rye, barley, and numerous grass species [4,5].

The pathogen P. tritici-repentis can survive saprophytically on infected wheat stubble and plant residues [6]. The infection begins when ascospores infect young wheat seedling leaves and produce lesions. These lesions are small tan-brown spots with a yellow halo that later expand [7]. As the disease progresses, tan spot lesions gradually merge, resulting in a substantial area of necrotic tissue [8]. Sporulation in Pyrenophora species plays an important role in the morphological characterization of conidia, aiding in the identification of isolates and subsequent research [9].

Previous studies have reported that this pathogen causes 20-50% of severe yield losses in wheat production [10,11]. Various fungicides have been reported to be effective in controlling P. tritici-repentis. These include azoxystrobin and trifloxystrolin, which inhibit respiration and energy production in fungal cells; iprodione, which inhibits signal transduction; mancozeb, which inhibits multi-site contact activity; and cyproconazole, tebuconazole, flutriafol, flusilazole, epoxyconazole, difenoconazole, and propiconazole, all of which inhibit sterol biosynthesis in the membrane [12]. Azoxystrobin and trifloxystrobin belong to the quinone outside inhibitor (QoI) fungicides [13].

In April 2021, numerous tan spot lesions were observed in commercial wheat fields, and potential causal pathogens were isolated from these lesions. The objectives of this study were to identify the fungal pathogens responsible for tan spot disease in wheat and select an appropriate fungicide to control these pathogens. Until now, scant information has been available on P. tritici-repentis isolates present in wheat in Korea.

Locus	Primer	Sequence (5′-3′)	Reference
ITS	ITS5	GGAAGTAAAAGTCGTAACAAGG	[19]
	ITS4	TCCTCCGCTTATTGATATGC	[19]
LSU	LR0R	GTACCCGCTGAACCTTAAGC	[20]
	LR5	ATCCTGAGGGAAACTTC	[20]
gapdh	gpd1	CAACGGCTTCGGTCGCATMG	[21]
	gpd2	GCCAAGCAGTTGGTTGTGGC	[21]
rpb2	RPB2-5F2	GGGGWGAYCAGAAGAAGGC	[22]
	fRPB2-7cR	CCCATRGCTTGYTTRCCCAT	[22]

Species	Strains	GenBank Aceession Numbers				References
Species	Strains	ITS	LSU	gapdh	rpb2	References
Pyrenophora tritici-repentis	KACC 41061	OP615072	OP615075	OR260448	2722450	Present study
P. tritici-repentis	SYP-F0557	OR265491	OR265489	OR260449	2722450	Present study
	SYP-F0558	OR265492	OR265490	OR260450	2722450	Present study
	CBS 259.59	MK540017	MK540075	AM884276	MK540143	[9, 28]
	CBS 191.29	MK540018	MK540076	MK540229	MK540144	[28]
	CBS 127922	MK540019	MK540077	MK540230	MK540145	[28]
P. variabilis	CBS 127920	MK540020	MK540078	MK540231	MK540146	[28]
P. avenicola	CBS 307.84	MK539972	MK540042	MK540180	–	[28]
P. chaetomioides	CBS 279.31	MK539977	MK540045	MK540185	MK540103	[28]
P. cynosuri	CBS 127918	MK539980	MK540047	MK540188	MK540106	[28]
P. leucospermi	CBS 111083	JN712467	JN712533	MK540198	MK540114	[28, 29]
P. nisikadoi	CBS 190.29	KM257054	KM243296	KM257057	–	[28]
P. novozelandica	CBS 127934	MK539997	MK540061	MK540209	MK540125	[28]
P. poae	CBS 319.68	MK539998	MK540062	MK540210	MK540126	[28]
P. pseudoerythrospila	CBS 127931	MK540000	MK540063	MK540212	–	[28]
P. teres	CBS 228.76	MK540003	MK540066	MK540215	MK540130	[28]
P. teres	CBS 281.31	MK540004	MK540067	MK540216	MK540131	[28]
Bipolaris panici-miliacei	CBS 199.29	KJ909773	KM243281	KM0042896	–	[28]
B. yamadae	CBS 202.29	KJ909779	KM243275	–	KM034830	[28]

Korean Journal of Mycology (Kor. J. Mycol.)

Indexed in SCOPUS, KCI, DOAJ

OPEN ACCESS, PEER REVIEWED

pISSN 2288-8187
eISSN 2289-0866

First Report of Pyrenophora tritici-repentis in Wheat (Triticum aestivum L.) in Korea and in vitro Selection of an Effective Fungicide

ABSTRACT

INTRODUCTION

MATERIALS AND METHODS

RESULTS AND DISCUSSION

REFERENCE

RESEARCH ARTICLE