Control of Ginseng Damping-off by Streptomyces sp. A75 and A501

이 상엽  Sang-Yeop Lee1*송 재경  Jaekyeong Song1윤 봉식  Bong-Sik Yun1박 경훈  Kyeong hun Park2김 정준  Jeong Jun Kim3한 지희  Ji Hee Han3

Abstract

Streptomyces sp. A75 and A501 inhibited the mycelial growth of pathogenic Rhizoctonia solani and Pythium sp., which cause the ginseng disease known as damping-off. Three methods were evaluated for the control of these pathogens, using a mixture of the culture broths from Streptomyces sp. A75 and A501. The methods tested were seed dipping with 50-fold diluted broth, drenching of soil with 100-fold diluted broth after sowing, and combined seed dipping and drenching. These methods reduced the incidence of ginseng damping-off caused by R. solani by 81.3%, 84.8%, and 32.2% and that caused by Pythium sp. by 51.0%, 52.1%, and 75.3%, respectively. Based on these results, the combination of seed dipping and soil drenching after sowing using a mixture of the culture broths from Streptomyces sp. A75 and A501 effectively reduced the incidence of damping- off in ginseng.

Keyword



서론

국인삼은 두릅나무과에 속하는 다년생작물로서 약용으로 사 포닌 성분인 진세노사이드에 관련된 약리 성분이 있어 원 기를 보하고 신체허약, 권태, 피로, 식욕부진, 구토, 설사에 쓰이며, 면역력 증강이나 노화예방 등으로 사용되고 있다 1-5]. 인삼에 발생하는 잘록병은 병원균이 Rhizoctonia solani, Pythium ultimum, P. debaryanum으로 보고되어 있다 [6].

이들 병원균은 토양에 존재하는 토양전염성으로 온도가 낮고 수분이 많은 토양에서 다발생한다[7]. Rhizoctonia solani에 의한 잘록병은 4월 중하순에 시작하여 5월 상순에 걸쳐 발생하며 땅에 접한 줄기부위에 암갈색으로 마르면서 쓰러지며, 주변으로 진전은 둥글게 퍼져 나가는 발병 특징 을 보이며 종자 발아 직후 어린 줄기를 침입하여 출아되지 못하는 출아전 잘록병과 출아후 마르면서 쓰러지는 증상이 며, P. ul t imum에 의한 잘록병이 5월 하순 이후 발생하고 줄기부위가 흐물거리며 물러썩는 증상을 보여 인삼의 묘 생산에 심각한 피해를 주는 식물병원균이다[8]. 인삼 잘록 병은 묘삼 생산의 성패와 직결되는 가장 중요한 병해 중의 하나로 잘록병의 피해는 19~30% 발생한다고 하였다[9].

인삼 잘록병 방제를 위하여 유기합성농약의 오남용, 약제 내성 및 농업생태계 오염이 우려되며 친환경 안전 인삼 모 생산 · 공급하여 친환경 인삼 생산을 위하여 친환경 방제제 개발이 필요하다.

잘록병에 대한 미생물을 이용한 생물적 방제 연구는 Bacillus spp., Pseudomonas spp., Trichoderma spp., Gliocladium spp. 등이 있으며[10-12], 국내에서는 Kim 등[13]과 Joo 등 [14]은 R. solani AG-4와 P. ul t imum에 의한 채소류의 모잘 록병에 B. ehimensis를 이용하였으며, Jo 등[15]은 고추와 오이의 R. solani와 P. ul t imum에 대하여 Serenade (Bacillus subtilis QST713) 제품의 방제 효과, 그리고 최근에 Woo 등[16]은 Streptomyces A3265균주의 인삼 잘록병 방제 효 과를 검토한 바 있다.

특히 Streptomyces속 균을 포함한 여러 방선균은 세포벽 을 분해효소나 항균 물질 생성 능력이 있어 곰팡이의 균사 생장을 억제하는 능력이 있기 때문에[17-19] 식물병을 친 환경적으로 방제에 활용할 수 있을 것으로 생각된다.

따라서 본 연구에서는 환경친화적 안전 인삼모를 생산하 기 위하여 사용한 방선균 균주가 인삼에 발생하는 잘록병 균에 대한 생육억제 효과와 인삼 잘록병에 대한 방제 효과 검정을 실시하였다.

재료 및 방법

방선균 및 병원균 보관

충남 계룡산의 토양에서 분리하여 식물병원균에 항균력 있는 방선균 A75와 A501 균주는 전북대로부터 분양받았 으며, modified Bennett’s agar (MBA, glucose 5 g, soluble starch 5 g, malt extract 1 g, yeast extract 1 g, N-Z amine 1 g, agar 15 g/L) 배지에서 배양한 다음 10o C에 보관하면서 계대배양하여 사용하였다. 인삼에 병원성 있는 R. solani와 Pythium sp. 균주는 원예특작과학원 인삼과로부터 분양받 아서 10 o C 항온기에 potato dextrose agar (PDA) 사면배지 로 보관하면서 사용하였다.

방선균 및 잘록병균 배양

방선균 A75와 A501 균주는 GSS (soluble starch 10 g, glucose 20 g, soybean flour 25 g, beef extract 1 g, yeast extract 4 g, NaCl 2 g, K2HPO4 0.25 g, CaCO3 2 g/L, pH 7.0) 배지를 이용하였으며, 1 L 삼각플라스크에 200 mL씩 분주한 후 25 o C에서 150 rpm으로 7일간 진탕 배양하여 사 용하였다. 잘록병균은 R. solani와 Pythium sp. 균주는 방제 효과 검정을 위하여 PDA에서 25 o C에서 5일간 배양한 후 에 각 균주의 균총을 떼어내어 2회 멸균한 보리배지에 접 종하여 25 o C에서 2주간 배양후 접종원으로 사용하였다.

방선균의 인삼 잘록병균에 대한 항균활성 검정

식물병원균 R. solani와 Pythium sp. 균주를 PDA 배지에 이식 후 28oC에서 5일간 배양하여 직경 5 mm인 코르크보 러를 이용하여 병원균의 균총을 PDA 배지가 분주된 일회 용 페트리디쉬 중앙에 치상하였다. 방선균 A75와 A501 균 주를 MBA 평판배지에 배양하여 루프를 이용하여 방선균 을 떼어내어 PDA 배지가 분주된 일회용 페트리디쉬에 3개소에 치상하여 28 oC 항온기에서 7일간 배양 후 저지원 의 직경을 조사하였다.

방선균 A75와 A501 균주의 휘발성 물질 생성에 의한 R solani와 Pythium sp. 균주의 항균력 조사는 I 플레이트를 이용하여 tryptic soy agar (TSA) 배지와 PDA 배지를 분 주하여 방선균을 TSA 배지에 도말하여 5일간 25 oC에서 배양한 다음, PDA 배지에서 배양한 R. solani와 Pythium sp. 균총을 직경 5 mm인 코르크보러를 이용하여 균총을 PDA 배지가 분주된 I 플레이트에 치상하여 25 oC에서 3일간 배양한 후 조사하였다.

방선균의 동정

선발 균주의 동정은 16S rRNA 유전자의 염기서열을 분석 하였다. 선발 균주는 GYM (glucose 4 g, yeast extract 4 g, malt extract 10 g, CaCO3 2 g, agar 12 g/L) 배지에 치상하 여 28oC에서 48시간 이상 배양한 후 원심분리하여 균체를 수확하였다. QIAamp DNA mini kit (Qiagen, German- town, MD, USA)를 이용하여 genomic DNA를 추출하였다. 16S rRNA 유전자는 범용 프라이머인 27F와 1492R을 사용 하여 PCR한 후 각각 유전자의 증폭산물을 얻었다[20]. 16S rRNA 유전자의 염기서열 분석은 3개의 프라이머(518F; CCAGCAGCCGCGGTAATACG, 800R; TACCAGGGTAT CTAATCC, 984F; ACGCGARGAACCTTAC)를 이용하여 분석하도록 제노텍(Geno-Tech, Daejeon, Korea)에 의뢰하 였다. 얻어진 염기서열은 SeqMan (DNASTAR, Madison, WI, USA)을 이용하여 직접 오류를 검정하고 연결하였다. 계통분석을 하기 위해서 표준균주의 16S rRNA 유전자 염 기서열은 EzTaxon-e 서버를 통해서 얻었다[21]. 계통도의 작성을 위해 MEGA 5.0 프로그램의 Clustal W 프로그램으로 염기서열을 정렬하였으며, Neighbor-joining 알고리즘을 사용하고 1,000회 반복 bootstraping을 통해 계통도의 신뢰 성을 확인하였다[22].

방선균의 인삼 잘록병 방제 효과 검정

어상자(500 × 340 × 400 mm)에 인삼재배용 상토(Shin- sung Mineral, Goesan, Korea)를 사용하여 개갑 인삼 종자 를 상자당 54립씩 3반복으로 파종하였다. 병원균 R. solani 와 Pythium sp. 균주의 배양은 PDA 배지에 배양한 후 보 리배지에 균총을 이식하여 25 oC에서 15일간 배양하여 접 종원으로 사용하였다. 방선균 A75와 A501 균주를 GSS 배 지에서 7일간 배양한 배양액을 사용하였다.

방선균의 Rhizoctonia solaniPythium sp. 에 대한 방제 효과 검정

종자 침지처리는 방선균 A75와 A501 균주를 GSS 배지에 서 7일간 배양한 각각의 배양액을 10배와 20배로 희석하여 인삼 개갑종자를 1시간 침지한 후 파종하였다. 그리고 관 주처리는 인삼 개갑종자를 파종 직후 균주별 배양액을 10배와 20배로 희석하여 주당 10 mL씩 7일 간격 3회 관주처 리하였다. 모든 처리에서 병원균의 접종은 병원균 R. solani 와 Pythium sp.을 각각 배양한 보리를 상자당 0.5 g/상자 접종하였고, 접종 4주 후에 이병주를 조사하였다.

방선균 배양액 혼합처리에 의한 Rhizoctonia solani와 Py- thium sp.에 대한 방제효과 검정

방선균 A75와 A501 균주를 GSS배지에서 7일간 배양한 각각의 배양액을 1:1 (v/v)로 혼합하여 사용하였다. 종자침 지 처리구는 방선균 A75와 A501 균주의 혼합한 배양액을 50배로 희석하여 개갑종자를 1시간 침지하여 어상자에 파 종하였다. 또한 관주 처리구는 인삼 개갑종자를 어상자에 파종한 직후 2균주의 배양한 혼합액을 100배로 희석하여 주당 10 mL씩 처리하였고, 20일후에 7일 간격 3회 관주처 리하였다. 그리고 종자 침지처리와 관주처리한 혼합 처리구 는 종자를 배양한 혼합액 50배로 침지처리하여 파종한 직 후에 배양한 혼합액을 100배로 희석하여 주당 10 mL씩 관 주처리하였으며, 20일 후에 7일 간격 3회 관주처리하였다. 병원균의 접종은 병원균을 각각 배양한 보리를 인삼종자 파종 20일 후에 상자당 0.5 g/상자씩 접종하여, 인삼종자의 발아와 잘록병 발생은 병원균 접종 42일 후에 조사하였다.

결과 및 고찰

인삼 잘록병균에 대한 항균활성

Streptomyces sp. A75와 A501 균주의 인삼에 병원성 있는 R. solani와 Pythium sp.에 대하여 균사생장 억제를 조사한 결과, R. solani에 대하여 A75 균주가 14.2 mm로 A501 균 주보다 균사생육 저지 효과가 우수하였으며, Pythium sp.에 대하여 A501 균주가 3.3 mm로 A75 균주보다 균사생육을 억제하였으나 미약하였다(Table 1, Fig. 1). Streptomyces sp. A75와 A501 균주의 휘발성 물질생성에 의한 R. solani와 Pythium sp.의 균사생육 억제 효과를 조사한 결과에서는 Streptomyces sp. A75와 A501 균주 모두가 R. solani에 대하 여 억제 효과가 미약하였고(Fig. 2), Pythium sp.에 대한 억 제 효과는 없었다. Streptomyces sp. A75와 A501 균주의 R.solaniPythium sp.에 대하여 항균활성을 나타낸 것은 R. solani에 항균활성을 갖는 방선균 A2365 균주의 guanidyl- fungin A와 methyl guanidylfungin A의 활성 성분을 동정 된 바와 같이 Streptomyces속 균이 세포벽 분해효소 생성하 거나 항곰팡이물질 등을 생성하여[16-19] 나타난 결과로 추

Table 1. Antifungal activity of Streptomyces sp. A75 and A501 on fungal pathogens of ginseng incubated in 28 oC for 6days on PDA agar http://dam.zipot.com:8080/sites/ksom/files/0100440417_image/Table_KSOM_44_04_17_T1.jpg
PDA, potato dextrose agar.
Fig. 1

Inhibition effect of mycelial growth of ginseng patho- genic fungi, Rhizoctonia solani (A) and Pythium sp. (B) by Streptomyces sp. A75 and A501.

http://dam.zipot.com:8080/sites/ksom/files/0100440417_image/Figure_KSOM_44_04_17_F1.jpg
Fig. 2

Inhibition effect of mycelial growth of Rhizoctonia solani by volatile of Streptomyces sp. A75 and A501 on I plate.

http://dam.zipot.com:8080/sites/ksom/files/0100440417_image/Figure_KSOM_44_04_17_F2.jpg

방선균의 동정

방선균 동정을 위해 16S rRNA 유전자를 바탕으로 MEGA5 프로그램을 이용하여 분자유전학적인 계통도를 작 성하였다(Fig. 3). 16S rRNA 유전자를 바탕으로 작성한 계 통도에서 A75 균주는 Streptomyces yatensis NBRC 101000 T)와 99.9% 높은 상동성을 보였다(Fig. 3A) [23]. 계통도의 신뢰성을 확보하기 위한 Bootstrap 값도 99%로 높은 값을 나타내어 S. yatensis인 것으로 추정되었다. A501 균주는 . costaricanus group에 속해 있는 균주들(S. costaricanus . graminearus, S. murinus, S. griseofuscus)과 높은 상동성 을 보였다(Fig. 3B). 계통도의 신뢰성을 확보하기 위한 ootstrap 값도 100%로 높은 값을 나타내며, 높은 항균활 성을 나타내는 것을 볼 때 항선충 및 항균 활성을 가진 것 으로 알려진 S. costaricanus일 것으로 추정되나 정확한 동 정을 하기 위해서 높은 염기서열의 상동성을 보이는 4균 주와의 생리 · 생화학적인 분석이 추후 필요하다고 판단된 다[24].

Fig. 3

Phylogenetic tree of isolates, A75 (A) and A501 (B), and related type strains of Streptomyces species based on partial 16S rRNA gene sequences (1413 bp). Numbers above branches indicate bootstrap values of neighbor-joining analysis (> 50%) from 1,000 replicates.

http://dam.zipot.com:8080/sites/ksom/files/0100440417_image/Figure_KSOM_44_04_17_F3.jpg

방선균주별 Rhizoctonia solaniPythium sp. 에 대한 방제효과

방선균주별 Rhizoctonia solaniPythium sp. 에 대한 방제효과

방선균주의 배양액을 희석하여 Rhizoctonia solani에 처리 한 결과, A75 균주가 A501 균주보다 처리 효과가 높았으며, 인삼 종자의 침지처리가 토양에 관주처리구보다 효과적이 었다. A75 균주의 배양액을 20배로 희석하여 종자침지처리 가 80.9% 방제 효과를 나타내었지만 통계적 유의성은 없었 다(Table 2).

Table 2. Control effect of ginseng damping-off caused by Rhizoctonia solani using cultured broth of Streptomyces sp. A75 and A501 http://dam.zipot.com:8080/sites/ksom/files/0100440417_image/Table_KSOM_44_04_17_T2.jpg
a)In a column, means followed by a common letter are not significantly different at the 5% level by Duncan’s multiple range test.

Pythium sp.에 대하여 A501 균주가 A75 균주보다 처리 효과가 높았으며, 관주처리가 종자 침지처리보다 효과적이 었다. A501 균주의 배양액을 10배로 희석하여 토양 관주처 리가 85.8%, 20배 희석액의 토양 관주처리가 56.7% 방제 효 과를 나타내었지만 통계적 유의성은 없었다(Table 3). 이들 결과는 항균활성검정 결과와 같이 A75 균주가 R. solani에 항균력이 있어 방제 효과가 높았으며, Pythium sp.에는 방 제 효과가 없었다. A501 균주는 R. solani에 효과가 낮았으 나, Pythium sp.에는 높은 방제 효과를 나타내었다. 미생물 제 Serenade (Bacillus subtillis QST713)는 R. solani에 의한 고추와 오이의 잘록병 방제에 9배 희석하여 관주처리로 58%와 54% 방제 효과를 각각 나타내었으며, P. u l t imum에 의한 고추와 오이의 잘록병을 9배 희석액으로 관주처리하여 각각 57%와 7.7% 방제 효과를 나타내었지만[15], A501 균주와 A75 균주가 잘록병 방제효과가 높아서 우수한 균주 라 생각되었다.

Table 3. Control effect of ginseng damping-off caused by Pythium sp. using cultured broth of Streptomyces sp. A75 and A501 http://dam.zipot.com:8080/sites/ksom/files/0100440417_image/Table_KSOM_44_04_17_T3.jpg
a)In a column, means followed by a common letter are not significantly different at the 5% level by Duncan’s multiple range test.

방선균주 배양액 혼합처리의 Rhizoctonia solani와 Pyth- ium 에 대한 방제효과

인삼 잘록병의 병원균은 R. solani, Pythium spp.로 보고 되어 있어 한번에 두 잘록병균을 방제하기 위하여 2개 균 주의 방선균의 배양액을 같은 비율(1:1, v/v)로 혼합하여 R. olani에 대하여 처리한 결과, 방선균처리는 종자발아에 영 향을 미치지 않았으며, 2균주의 배양액을 혼합한 50배 희석 액을 인삼 종자 침지처리가 81.3%, 100배 희석액의 관주처 리가 84.8%로 높은 방제효과를 보였으나, 종자 침지처리와 토양 관주처리를 같이 처리한 구에서는 32.3%로 방제효과 가 저조하였다(Table 4, Fig. 4). Pythium sp.에 대해서는 종 자 침지처리와 토양 관주처리가 각각 51.0%와 52.1%의 방 제 효과를 나타내었고, 종자 침지처리와 토양 관주처리한 혼합 처리구에서는 75.3%로 방제효과를 보였다(Table 5, (Fig. 5). 이상의 결과를 요약하면, 방선균 2균주의 배양액을 혼합액은 R. solani에 의한 잘록병은 종자 침지 또는 토양관주, Pythium sp.에 의한 잘록병은 종자 침지와 토양 관주 처리를 혼합 처리한 것이 75~84.8%의 방제효과를 나타내 어 Woo 등[16]의 방선균 A3265의 배양액에 종자 침지처리 하여 음건한 종자를 파종한 시기에 따라서 인삼 잘록병이 1.0~6.3%, 무처리가 4.5~19.2% 발병하여 67.2~77.8% 방제 효과로 이 방선균주보다 방제효과가 높았다. 또한 Cho 등 [15]에 의하면 R. solani에 의한 잘록병은 4월 중하순에 시 작하여 5월 상순에, P. u l t imum에 의한 잘록병이 5월 하순 이후에 발생한다는 보고에 의하면 인삼종자 파종 시에 방 선균 A75와 A501 균주의 배양액을 혼합하여 종자 침지처 리하고 토양 관주처리를 같이 처리하는 것이 두 병원균에 의한 잘록병의 방제효과를 높일 수 있다고 생각된다.

Fig. 4

Control effect of mixing treatment (1:1 v/v) of the cultured broth of Streptomyces sp. A75 and A501 on ginseng damping- off caused by Rhizoctonia solani. A, dipping; B, drenching; C, dipping + drenching; D, untreated check.

http://dam.zipot.com:8080/sites/ksom/files/0100440417_image/Figure_KSOM_44_04_17_F4.jpg
Table 4. Control effect of ginseng damping-off caused by Rhizoctonia solani using mixing treatment (1:1, v/v) of the cultured broth of Streptomyces sp. A75 and A501 incubated on 25oC with 160 rpm for 7 days in GSS medium http://dam.zipot.com:8080/sites/ksom/files/0100440417_image/Table_KSOM_44_04_17_T4.jpg
GSS, soluble starch 10 g, glucose 20 g, soybean flour 25 g, beef extract 1 g, yeast extract 4 g, NaCl2g, K2HPO4 0.25 g, CaCO32 g/L, pH 7.0. a)In a column, means followed by a common letter are not significantly different at the 5% level by Duncan’s multiple range test.

이와 같이 방선균 A75와 A501 균주가 R. solani와 Pyth- ium sp.에 대하여 항균활성이 있으며, 인삼 잘록병에 방제 효과를 나타내어 활용 가능성이 있다고 생각된다.

Table 5. Control effect of ginseng damping-off caused by Pythium sp. using mixing treatment (1:1, v/v) of the cultured broth of Streptomyces sp. A75 and A501 incubated on 25oC at 160 rpm for 7 days in GSS media http://dam.zipot.com:8080/sites/ksom/files/0100440417_image/Table_KSOM_44_04_17_T4.jpg
GSS, soluble starch 10 g, glucose 20 g, soybean flour 25 g, beef extract 1 g, yeast extract 4 g, NaCl 2 g, K HPO 0.25 g, CaCO2 g/L, pH 7.0 a)In a column, means followed by a common letter are not significantly different at the 5% level by Duncan’s multiple range test.
Fig. 5

Control effect of mixing treatment (1:1, v/v) of the cultured broth of Streptomyces sp. A75 and A501 on ginseng dampingoff caused by Pythium sp. A, dipping; B, drenching; C, dipping + drenching; D, untreated check.

http://dam.zipot.com:8080/sites/ksom/files/0100440417_image/Figure_KSOM_44_04_17_F5.jpg

방선균주 배양액 혼합처리의 Rhizoctonia solani와 Pyth- ium 에 대한 방제효과

Streptomyces sp. A75와 A501 균주는 인삼 잘록병을 일으 키는 R. solani와 Pythium sp.의 균사 생장을 억제하였다. 인삼 잘록병 R. solani에 대하여 Streptomyces sp. A75와 A501 균주의 배양액을 혼합한 50배 희석액에 종자 침지처리, 100배 희석액의 관주처리와 종자 침지처리(50배) + 관주처 리(100배)는 81.3%, 84.8%와 32.2%의 방제 효과를 각각 나타내었다. 인삼 잘록병 Pythium sp.에 대하여 Streptomyces sp. A75와 A501 균주의 배양액을 혼합한 50배 희석액에 종 자 침지처리, 100배 희석액의 관주처리와 종자 침지처리 (50배) + 관주처리(100배)는 51.0%, 52.1%, 75.3%의 방제효과를 각각 나타내었다. 이들 결과에서 Streptomyces sp. A75와 A501 균주의 배양한 혼합액으로 종자 침지한 후 관 주처리가 인삼 잘록병 발생을 효과적으로 감소시켰다.

적요

Streptomyces sp. A75와 A501 균주는 인삼 잘록병을 일으 키는 R. solani와 Pythium sp.의 균사 생장을 억제하였다. 인삼 잘록병 R. solani에 대하여 Streptomyces sp. A75와 A501 균주의 배양액을 혼합한 50배 희석액에 종자 침지처리, 100배 희석액의 관주처리와 종자 침지처리(50배) + 관주처 리(100배)는 81.3%, 84.8%와 32.2%의 방제 효과를 각각 나타내었다. 인삼 잘록병 Pythium sp.에 대하여 Streptomyces sp. A75와 A501 균주의 배양액을 혼합한 50배 희석액에 종 자 침지처리, 100배 희석액의 관주처리와 종자 침지처리 (50배) + 관주처리(100배)는 51.0%, 52.1%, 75.3%의 방제효과를 각각 나타내었다. 이들 결과에서 Streptomyces sp. A75와 A501 균주의 배양한 혼합액으로 종자 침지한 후 관 주처리가 인삼 잘록병 발생을 효과적으로 감소시켰다.

Acknowledgements

This work was supported by a grant from the Agenda Project (Grant No. PJ009951032016) of the Rural Devel- opment Administration, Republic of Korea.

References

1 Li YB, Wang Y, Tang JP, Chen D, Wang SL. Neuroprotective effects of ginsenoside Rg1-induced neural stem cell transplantation on hypoxic-ischemic encephalopathy. Neural Regen Res 2015;10:753-9.  

2 Saba E, Jeon BR, Jeong DH, Lee K, Goo YK, Kim SH, Sung CK, Roh SS, Kim SD, Kim HK, et al. Black ginseng extract ameliorates hypercholesterolemia in rats. J Ginseng Res 2016; 40:160-8. 

3 Gui QF, Xu ZR, Xu KY, Yang YM. The efficacy of ginseng- related therapies in type 2 diabetes mellitus: an updated sys- tematic review and meta-analysis. Medicine (Baltimore) 2016; 95:e2584. 

4 Jang KJ, Choi SH, Yu GJ, Hong SH, Chung YH, Kim CH, Yoon HM, Kim GY, Kim BW, Choi YH. Anti-inflammatory potential of total saponins derived from the roots of Panax ginseng in lipopolysaccharide-activated RAW 264.7 macropha-ges. Exp Ther Med 2016;11:1109-15.  

5 Lee DY, Jeong YT, Jeong SC, Lee MK, Min JW, Lee JW, Kim GS, Lee SE, Ahn YS, Kang HC, et al. Melanin biosynthesis inhibition effects of ginsenoside Rb2 isolated from Panax ginseng berry. J Microbiol Biotechnol 2015;25:2011-5. 

6 The Korean Society of Plant Pathology. List of plant diseases in Korea, 5th ed. Seoul: Korean Society of Plant Pathology; 2009. 

7 Agrios, GN. Plant pathology. 5th ed. Boston: Elsevier Academic Press; 2005.  

8 Cho DH, Cho HS, Shin JS, Park DW. Control of damping-off and ginseng stem fungus gnat of ginseng. In: KT&G Ginseng research report, 2007. p. 28-33.  

9 Hong SK. Survey of ginseng cultivation in Southern Korea. So-yeun (Central Monopoly Institute) 1964;6:27-44.  

10 Georgakopoulos DG, Fiddaman P, Leifert C, Malathrakis NE. Biological control of cucumber and sugar beet damping-off caused by Pythium ultimum with bacterial and fungal antag- onists. J Appl Microbiol 2002;92:1078-86. 

11 Howell CR, Stipanovic RD. Suppression of Pythium ultimum- induced damping-off of cotton seedlings by Pseudomonas flu-orescens and its antibiotic, pyoluteorin. Phytopathology 1980; 70:712-5. 

12 Zamanizadeh HR, Hatami N, Aminaee MM, Rakhshandehroo F. Application of biofungicides in control of damping disease off in greenhouse crops as a possible substitute to synthetic fungicides. Int J Environ Sci Technol (Tehran) 2011;8:129-36.  

13 Kim JH, Choi YH, Kang SJ, Rhee IK, Joo GJ. Biocontrol of vegetables damping-off by Bacillus ehimensis YJ-37. Kor J Life Sci 2002;12:416-22. 

14 Joo GJ, Kim JH, Kang SJ. Isolation and antifungal activity of Bacillus ehimensis YJ-37 as antagonistic against vegetables dam- ping-off fungi. Kor J Life Sci 2002;12:200-7. 

15 Jo EJ, Kang BG, Jang KS, Choi YH, Kim JC, Choi GJ. Control efficacy of serenade formulation against Rhizoctonia and Pyth-ium damping-off diseases. Res Plant Dis 2014;20:201-5.10.5423/RPD.2014.20.3.201 

16 Woo EE, Lee GS, Lee IK, Choi JE, Yun BS. Control of ginseng damping-off by Streptomyces sp. A3265. Kor J Mycol 2016;44: 193-5.  

17 Lahdenpera ML. Streptomyces-a new tool for controlling plant diseases. Agro Food Ind Hi Tech 1991;2:25-7.  

18 Elson MK, Kelly JF, Nair MG. Influence of antifungal compo- unds from a soil-borne actinomycete on Fusarium spp. in aspa- ragus. J Chem Ecol 1994; 20:2835-46. 10.1007/BF02098392 

19 Handelsman J, Stabb EV. Biocontrol of soilborne plant patho- gens. Plant Cell 1996;8:1855-69. 10.1105/tpc.8.10.1855 

20 Song J, Lee SC, Kang JW, Baek HJ, Suh JW. Phylogenetic ana- lysis of Streptomyces spp. isolated from potato scab lesions in Korea on the basis of 16S rRNA gene and 16S-23S rDNA int- ernally transcribed spacer sequences. Int J Syst Evol Microbiol2004;54:203-9.10.1099/ijs.0.02624-0 

21 Kim OS, Cho YJ, Lee K, Yoon SH, Kim M, Na H, Park SC, Jeon YS, Lee JH, Yi H, et al. Introducing EzTaxon-e: a proka- ryotic 16S rRNA gene sequence database with phylotypes that represent uncultured species. Int J Syst Evol Microbiol 2012; 62:716-21. 10.1099/ijs.0.038075-0 

22 Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011;28:2731-9. 10.1093/molbev/msr121 

23 Saintpierre D, Amir H, Pineau R, Sembiring L, Goodfellow M. Streptomyces yatensis sp. nov., a novel bioactive streptomycete isolated from a New-Caledonian ultramafic soil. Antonie Van Leeuwenhoek 2003;83:21-6. 10.1023/A:1022906325397 

24 Esnard J, Potter TL, Zuckerman BM. Streptomyces costaricanus sp. nov., isolated from nematode-suppressive soil. Int J Syst Bacteriol 1995;45:775-9.10.1099/00207713-45-4-775