Introduction
Cancer cells have been both directly and indirectly associated with the dysregulation of the blood coagulation cascade [1]. Vascular injury or inflammation may disrupt blood flow, resulting in the formation of a blood clot or thrombus that finally interferes with hemostasis. The thrombus consists of two components, a plug of aggregated platelets and fibrinogen.
Thrombin plays a key role in the activation of the coagulation cascade, and represents, at present, one of the most intriguing targets for the development of new therapeutic agents for the treatment of thrombotic disorders [2]. Currently, several pharmacotherapies (e.g., antiplatelet, antithrombotic, anticoagulant and thrombolytic agents) are approved for the treatment of thrombotic disorders [3-5]. Antithrombotic agents, particularly, are a special focus of interest in treating metastasis. Several studies have reported that thrombin induces tumor cell invasion, which appears to correlate with matrix metalloproteinase-9 (MMP-9) expression [6-8]. Work in C6 glioma cells [6] and U2-OS cells [8] have demonstrated that thrombin-induced invasion and MMP-9 expression are regulated by the PI3K pathway. In addition, upregulation of MMP-9 expression has been reported in invasive human oral squamous cell carcinoma [9, 10].
Redox imbalance of antioxidants, reactive oxygen species (ROS) and reactive nitrogen species (RNS), can contribute to cancer development. At specific levels, ROS acts as a second messenger in certain cellular signaling pathways and plays a critical role in various biological functions such as cell division, aging, survival and death. Thus, at uncontrolled levels, ROS can cause a wide variety of human disorders and diseases, including cancers [11, 12]. Several studies indicate that antioxidants exhibit anti-invasive activity against cancer cells by inhibiting MMP expression [13, 14].
Mushrooms have various physiological properties, including anti-oxidative, anti- inflammatory, anti-thrombotic and anti-cancer effects, as well as promote immune responses. Consequently, its extracts have been the focus of intense research with a view towards developing new functional foods, medicines and cosmetics.
Laetiporus miniatuss, an edible medicinal mushroom growing on living or dead oak tree trunks, belongs to the family Polyporaceae in the order Polyporales. Its fruiting bodies have striking golden or yellow color [15, 16]. Previous studies have reported various compounds derived from L. miniatus, which include polysaccharides, benzofuran glycoside, acetylenic acid, lanostanoid triterpene and β-1,3-1,4-glucanase [16-19]. Other investigations have shown that extracts and specific fractions obtained from L. miniatus have various positive biological and pharmacological activities, including anti-tumor [20-22], anti-inflammatory [23, 24], anti-microbial, and anti-fungal activities. Some of these properties observed were seen with the hexane fraction isolated from L. miniatus lipid extracts [25]; while, specifically, anti-oxidant activities were seen with its hot water soluble and hot alkali soluble polysaccharides [26]. In addition, this mushroom is known to act as a chemo-therapeutic and an immune-modulating agent [25]. However, little is known about the effects of L. miniatus in the context of oral cancer migration. Accordingly, the aim of this study was to assess the potential therapeutic and anti-invasive activities of the aqueous and organic solvent extracts from L. miniatus on human oral squamous carcinoma cells.
Materials and Methods
Chemicals
1,1-diphenyl-2-picrylhydrazyl (DPPH), fibrinogen, thrombin, and phorbol 12-myristate 13-acetate (PMA) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Cell Counting Kit-8 (CCK-8) was obtained from Dojindo Laboratories (Rockville, MD, USA). H-D-phenylalanine-L-pipecolyl-L-arginine-paranitroaniline dihydrochloride was purchased from Chromogenix (Orangeburg, NY, USA).
Preparation of fractionations from a L. miniatus
The fruiting bodies of L. miniatus were collected from Chiaksan mountain. Five hundred gram of dried whole mushrooms of L. miniatus was milled into a powder and extracted with 50% aqueous methanol (5 L) for 3 days at room temperature, filtered and concentrated under reduced pressure. The residue (10 g) was diluted with 300 mL H2O and then successively partitioned with n-hexane, CHCl3, EtOAc, and n-BuOH (300 mL). Each fraction was evaporated under vacuum and lyophilized with a freeze dryer (Ilshin Lab Co. Ltd., Yangju, Korea) to yield a powder. The yields of fractions were given in Fig. 1. Dimethyl sulfoxide (DMSO) was added to completely dissolve the fractionated extracts and to dilute each extract to a final concentration of 10 mg/mL.
Cell culture
Human oral squamous carcinoma cell line YD-10B was obtained from Korea Cell Line Bank (Seoul, Korea). Cells were grown in RPMI-1640 with 10% Fetal Bovine Serum (Life technologies, Gaithersburg, MD, USA) at 37°C in humidified atmosphere with 5% CO2 incubator.
Estimation of antioxidant activity
The free radical-scavenging activity was determined using 1, 1-diphenyl-2-picrylhydrazyl (DPPH) according to the method of Blois [27] and Kim et al. [28]. A total volume of 0.4 mL of each fraction solution and 5.6 mL of 1×10-4 M DPPH ethanol solution were mixed. The mixtures were incubated for 10 min at room temperature. The absorbance of each well was measured at 525 nm using UV-vis spectrophotometer (UV-1201; Shimadzu, Kyoto, Japan). Each assay was performed in triplicate and DPPH activity was taken as the average of three independent tests.
DPPH activity was calculated as an inhibition percentage according to the following equation:
Scavenging effect (%) = {1 − [A525(sample) / A525(Blank)]} × 100
A525(Blank) was the absorbance of the control (deionized water, instead of the sample).
Estimation of thrombin inhibitory activity
Thrombin inhibitory activity was measured by the method of Doljak et al.[29]. 50 µL of thrombin solution (0.5 NIH units/mL) was diluted by 40 uL of Hanks’ balanced salt solution (HBSA) buffer (10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), 150 mM NaCl, 0.1% bovine serum albumin, pH 7.5). The diluted thrombin solution was mixed with 10 uL of solvent fractions (10 mg/mL) and incubated for 15 min. After 50 µL of 3 mM, H-D-phenylalanine-L-pipecolyl-L-arginine-paranitroaniline Dihydrochloride (substrate) was added to a thrombin mixture, the mixture was incubated for 5 min at room temperature, and the absorbance of each well was measured at 405 nm using UV-vis spectrophotometer (UV-1201, Shimadzu). Thrombin inhibitory activity was calculated as a percentage according to the following equation:
Inhibiting ability (%) = {1 − [A405(sample) / A405(Control)]} × 100
A405(control) was the absorbance of the control (thrombin solution, assay buffer, and substrate).
Cell viability assay
MTS cell proliferation assay was performed using Cell Counting Kit-8. YD-10B (2×104) cells were seeded in 96-well plates. After 16 hr incubation, cells were treated with solvent fractions at a various concentrations (0, 20, 40, 80 and 100 µg/mL), and incubated for 48hr. After treatment, CCK-8 solution (10 µL) was added to each well. After the plates were incubated for 3hr at 37°C, the absorbance of each well was measured at 450 nm using spectra Max microplate reader (Molecular Devices, Sunnyvale, CA, USA). Result was expressed as a percentage of growth, with control cells treated with DMSO alone having 100% of growth.
Reverse transcription-polymerase chain reaction (RT-PCR)
TRIzol Reagent (Thermo Fisher Scientific, Waltham, MA, USA) was used to extract total RNA from YD-10B cells. PCR was carried out using ReverTra ACE PCR RT Master Mix Kit containing (Toyobo, Osaka, Japan) 1 µg of total RNA. The samples were processed through 30 cycles consisting of 1 minute at 94°C, 1 minute at 58°C for MMP-2, 58°C for MMP-9, 58°C for glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and 1 minute at 72°C. A fragment of the human GAPDH gene amplified as an internal control. The oligodeoxynucleotides were synthesized as specific primers: MMP-2 forward primer, GCGACAAGAAGTATCGCTTC; MMP-2 reverse primer, TGCCAAGGTCAATGTCAGGA; MMP-9 forward primer, CCATTTCGACGATGACGAGTT; MMP-9 reverse primer, CTTGTCGCTGTCAAAGTTCGAG; GAPDH forward primer, GAAGGTGAAGGTCGGAGT; GAPDH reverse primer, GAAGATGGTGATGGGATTTC. Amplified products were electrophoresed on a 1.5% agarose gel containing ethidium bromide, visualized under UV light, and analyzed by use of a densitometer.
Gelatin Zymography
For the gelatinase activity, the supernatants of YD-10B cell cultures underwent electro-phoresis on an 8% polyacrylamide gel containing 0.1% (w/v) gelatin (from porcine skin, Type A). The gel was incubated at room temperature for 1hr in the presence of 2.5% triton X-100, 50 mM Tris-Cl pH 7.5, 10 mM CaCl2 and 1.0 uM ZnCl2) and subsequently at 37°C overnight in a buffer containing 10 mM CaCl2, 0.15 M NaCl and 50 mM Tris-Cl (pH 7.5). The gel was then stained for protein with 0.25% Coomassie blue and proteolysis was detected as a white zone within a dark zone. For quantification, gelatin zymograms were using a GelQuant.NET program.
Statistical analysis
Statistical analysis for anti-oxidant and anti-thrombin assay was performed with one-way ANOVA using Instat statistical software (GraphPad Software, Inc., La Jolla, CA, USA). For the statistical analysis of the cell viability assay, RT-PCR and gelatinase activity were obtained using Student’s t-test. Data were expressed as the mean ± standard derivation (SD) and considered statistically significant for p < 0.05. All results were presented as the average of at least three separate experiments.
Results and Discussion
Anti-oxidative effects of the water extract and solvent fractions from L. miniatus
ROS and RNS are reactive chemical species that trigger cell damage, which, in turn, can cause a wide variety of degenerative diseases. However, at a specific concentration, ROS also acts as a second messenger in certain cellular signaling pathways, and plays an important role in various biological functions such as cell division, aging, survival and death. Thus, when ROS reaches uncontrolled levels, it is can cause a wide variety of human disorders and diseases, including cancers [11, 12]. It is also known that this mushroom possesses antioxidant properties, with components harboring vitamin C, vitamin E and polyphenol compounds, for example [30]. Therefore, we investigated whether the water extract and solvent fractions of L. miniatus could function as potential preventive agents of various diseases by measuring their anti-oxidative effects by examining DPPH radical scavenging. As shown in Fig. 2, the highest activity was observed in the butanol fraction (81.44%), followed by the ethyl acetate fraction (77.70%); those of water, chloroform and hexane fractions were 39.82%, 25.52%, and 9.86%, respectively. These results suggest that the butanol and ethyl acetate fractions of L. miniatus might serve as potential antioxidant sources.
Thrombin inhibition effects of the water extract and solvent fractions from L. miniatus
Thrombin, which plays a critical role in blood coagulation, catalyzes the conversion of fibrinogen into fibrin, which, in turn, leads to the formation of a blood clot. Recently, there has been greater progress made towards the development of new therapeutic drugs, derived from medicinal foods that present with little side effects, for the treatment of thrombotic disorders [31, 32]. In this study, we sought to investigate whether the water extract and solvent fractions of L. miniatus could function as potential preventive agents of vascular disease by measuring its antithrombotic activity. As shown in Fig. 3, the highest inhibition (94.64%) was observed with the water extract, followed by the water fraction (at 90.10% of inhibition), with the fractions of butanol, chloroform, ethyl acetate and hexane fraction exhibiting 89.41%, 73.44%, 69.14%, and 64.97%, inhibition, respectively. Of note, these results corresponded to previous studies, where thrombin inhibition was significantly higher in the butanol fractions and organic solvent factions [33], suggesting that the fractions of L. miniatus might be evaluated for the treatment of thrombotic diseases and potentially used as a thrombin inhibitor.
Cell viability effects of the water extract and solvent fractions from the L. miniatus
To determine whether the cytotoxic effects of the water extract and solvent fractions from L. miniatus was attributable directly to cell death, the MTS cell proliferation assay was performed using the human oral squamous carcinoma cell line YD-10B (Fig. 4). Cells were treated with different concentrations (0, 20, 40, 80 and 100 µg/mL) of water extract and solvent fractions from L. miniatus for 48hr. At the high concentration of 100 µg/mL (as compared to control), cell viability effects of the water extract, ethyl acetate, butanol and water fractions remained constant with values of 88.01%, 95.84%, 92.18% and 83.02%, respectively; but major changes were observed with the hexane and chloroform fractions (Fig. 3). No significant cytotoxic effects were observed at concentrations of up to 40 µg/mL from the water extract nor the solvent fractions of L. miniatus.
Anti-thrombin effects of the water extract and solvent fractions from L. miniatus in YD-10B oral cancer cells
YD-10B cells demonstrate highly invasive activity through the collagen or Matrigel- coated transwell, both in vitro three-dimensional culture and in vivo tumorigenicity [34]. Many reports suggest that thrombin regulates the gelatinolytic activity of MMP-2 and MMP-9 in cancer cell invasion [7-10, 35]. However, the effect of thrombin on human oral squamous carcinoma cells is not fully understood. Thus, in this study we sought to evaluate whether the effects of the water extract and solvent fractions from L. miniatus are due to the regulation of thrombin-treated invasion. YD-10B cells were treated with different concentrations (0, 2.5, 3.5 and 4.5 U/mL) of thrombin for 24h in serum-free media. The YD-10B cells showed markedly low MMP-9 expression, with MMP-2 expression relatively higher than that of MMP-9. Additionally, while stimulation with thrombin (3.5 U/mL) led to a significant increase of MMP-9 expression, the expression of MMP-2 revealed no significant induction (Fig. 5).
PMA is widely used as a tumor promoter for the stimulation of cell invasion in various types of cancer cells [36-38]. In PMA-treated YD-10B cells, mRNA expression and protein activation of MMP-2/-9 were highly inhibited in the hexane and chloroform fractions (Fig. 6). When MMP-2 and MMP-9 mRNA expressions were analyzed in thrombin-treated YD-10B cells, only MMP-9 mRNA demonstrated significant induction by thrombin (3.5 U/mL). Specifically, upon stimulation with thrombin, the expression of MMP-9 mRNA increased 13-fold. More importantly, the mRNA expression of MMP-9 was markedly inhibited (by 50%) by the hexane and chloroform fractions, whereas activation of MMP-2 was only mildly inhibited (Fig. 7A). Protein activation of MMP-2 and MMP-9 in thrombin- treated YD-10B cells was confirmed by gelatin zymography (Fig. 7B). There was no significant difference in protein levels of MMP-2 and MMP-9 when induced by thrombin. Whereas, the hexane and chloroform fractions of L. miniatus were inhibited by 50%, MMP-2 and MMP-9 activations compared to the thrombin only treated group. This finding may lend further support to previous studies [20, 23], where acetyl eburicoic acid derived from the fruiting bodies of L. miniatus demonstrated potent anti-cancer effects on HL-60 human myeloid leukemia cells, resulting from apoptosis activation. Therefore, we suggest that the hexane and chloroform fractions of L. miniatus might serve as potential anti- invasive agents in oral cancer, although further experiments will need to be carried out in order to identify the active compounds present within the hexane and chloroform fractions of L. miniatus.
